Review



plko 1 shrictor plasmids  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc plko 1 shrictor plasmids
    Plko 1 Shrictor Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1264 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 shrictor plasmids/product/Addgene inc
    Average 96 stars, based on 1264 article reviews
    plko 1 shrictor plasmids - by Bioz Stars, 2026-04
    96/100 stars

    Images



    Similar Products

    plko 1 shrictor plasmids  (Addgene inc)
    96
    Addgene inc plko 1 shrictor plasmids
    Plko 1 Shrictor Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 shrictor plasmids/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    plko 1 shrictor plasmids - by Bioz Stars, 2026-04
    96/100 stars
    		  Buy from Supplier
    shrictor  (Addgene inc)
    93
    Addgene inc shrictor
    Shrictor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrictor/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    shrictor - by Bioz Stars, 2026-04
    93/100 stars
    		  Buy from Supplier
    plko shrictor #1853  (Addgene inc)
    90
    Addgene inc plko shrictor #1853
    Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
    Plko Shrictor #1853, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko shrictor #1853/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    plko shrictor #1853 - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    plko 1 shrictor  (Addgene inc)
    93
    Addgene inc plko 1 shrictor
    Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
    Plko 1 Shrictor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 shrictor/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    plko 1 shrictor - by Bioz Stars, 2026-04
    93/100 stars
    		  Buy from Supplier
    lentiviral plko 1 shrictor  (Addgene inc)
    93
    Addgene inc lentiviral plko 1 shrictor
    Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
    Lentiviral Plko 1 Shrictor, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral plko 1 shrictor/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    lentiviral plko 1 shrictor - by Bioz Stars, 2026-04
    93/100 stars
    		  Buy from Supplier
    shrictor plasmids  (Addgene inc)
    90
    Addgene inc shrictor plasmids
    Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
    Shrictor Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrictor plasmids/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    shrictor plasmids - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    pzip-mcmv-zsgreen-shrictor  (Transomic Technologies Inc)
    90
    Transomic Technologies Inc pzip-mcmv-zsgreen-shrictor
    Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
    Pzip Mcmv Zsgreen Shrictor, supplied by Transomic Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pzip-mcmv-zsgreen-shrictor/product/Transomic Technologies Inc
    Average 90 stars, based on 1 article reviews
    pzip-mcmv-zsgreen-shrictor - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    shrna expression vectors against human rictor (shrictor 1 shrictor 2  (Addgene inc)
    90
    Addgene inc shrna expression vectors against human rictor (shrictor 1 shrictor 2
    Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
    Shrna Expression Vectors Against Human Rictor (Shrictor 1 Shrictor 2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna expression vectors against human rictor (shrictor 1 shrictor 2/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    shrna expression vectors against human rictor (shrictor 1 shrictor 2 - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    shrictor vectors  (Addgene inc)
    90
    Addgene inc shrictor vectors
    Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 <t>shRictor</t> cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls
    Shrictor Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrictor vectors/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    shrictor vectors - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls

    Journal: Cell & Bioscience

    Article Title: NUAK1 coordinates growth factor-dependent activation of mTORC2 and Akt signaling

    doi: 10.1186/s13578-023-01185-2

    Figure Lengend Snippet: Comparative of NUAK1 inhibition versus mTOR inhibition on Akt signaling. A IB of combined inhibition of NUAK1 and mTOR on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or HTH-01-015 (10 µM) plus Torin1 (100 nM) before stimulation with EGF. B IB of Akt Ser-473 phosphorylation under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h of pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 60 min. C IB of NUAK1 and mTOR effect on Akt signaling. MDA-MB-231 cells were serum-starved overnight followed by 1-h of pretreatment with DMSO, HTH-01-015 (10 µM) or Torin1 (100 nM) before stimulation with EGF for 0 and 20 min. D Quantification of Akt signaling pathway from C . Each bar represents the mean ± SD, n = 3. Data from 3 independent experiments at 20 min of EGF stimulation were analyzed by student t test. E IB of Akt/TSC2 signaling under NUAK1 inhibition in MDA-MB-231 shCtrl and MDA-MB-231 shRictor cells. Stable cells were serum-starved overnight followed by 1-h pretreatment with DMSO or HTH-01-015 (10 µM) before stimulation with EGF for 20 min. GAPDH and/or α-tubulin were used as loading controls

    Article Snippet: To generate pCW57 FLAG-hNUAK1 WT, hNUAK1 WT was amplified from pCMV FLAG-hNUAK1 and subcloned into pCW57-MCS1-2 A-MCS2 using NheI and AgeI restriction sites. pCMV FLAG-hNUAK1 K84A was generated by subcloning of FLAG-hNUAK1 K84A from pBABE FLAG-hNUAK1 K84A using EcoRI restriction sites. pBABE FLAG-hNUAK1 K84A was previously generated by site direct mutagenesis using the following primers: hNUAK1_K84A_F: GGCCGAGTGGTTGCTATAGCCTCCATTCGTAAGG, hNUAK1_K84A_R: CCTTACGAATGGAGGCTATAGCAACCACTCGGCC. pCMV FLAG-NUAK1 K84A mutation was confirmed by sequencing (Additional file : Fig. S6). pCW57-MCS1-2 A-MCS2 (#71782), FLAG FOXO3a (#8360), pCMV dR8.2 (#8360), pCMV VSVG (#8454), pLKO scramble (#1864), pLKO shRictor (#1853), Lamp1-YFP (#2532), Lamp1-RFP (#1817), EGFR-GFP (#32751), pRK5 Myc Rictor (#11367), pRK5 Myc Raptor (#1859), and mRFP-Rab5 (#14437) from Addgene. pCMV6 Myr-Akt1-HA was kindly provided by Dr. Philip Tsichlis, The Ohio State University, Rab7-GFP by Dr. Julio Tapia, Universidad de Chile, Chile, and pINDUCER10 shNUAK1 #1 and shNUAK1 #2 by Drs. Giacomo Cossa and Martin Eilers, University of Würzburg, Germany.

    Techniques: Inhibition, Phospho-proteomics